Sequence ID | >WENV180704595 |
Genome ID | ODEJ01000001 |
Search identical group | |
Phylum/Class | [ODEJ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 137346 |
End posion on genome | 137421 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cggaggttgc |
tRNA gene sequence |
GGCCCCATCGTATAGCGGCCTAGTACTCCGCCCTCTCACGGCGGCAACACCGGTTCAAAT |
Downstream region at tRNA end position |
ctaggaaata |
Secondary structure (Cloverleaf model) | >WENV180704595 Glu CTC c ACCA ctaggaaata G - C G + T C - G C - G C - G C - G A - T T A T T G G C C A C G A C | | | | | A G T A T G A C C G G C G + | | | T T C G T A C C T A T CAAC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |