Sequence ID | >WENV180706645 |
Genome ID | ODES01001582 |
Search identical group | |
Phylum/Class | [ODES] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 81 |
End posion on genome | 7 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggtgcacctg |
tRNA gene sequence |
GGGCGTATAGCTCAGTTGGTCAGAGCGCCTGCCTTACACGCTGGAGGTCGCCGGTTCGAG |
Downstream region at tRNA end position |
ccacnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180706645 Val TAC g ACtt ccacnnnnnn G - C G - C G - C C - G G - C T + G A - T C G T C G G C C A T G A A | | | | | G T C T C G G C C G G C G | | | | T T G G A G C T C A G AGGTC C - G C - G T T G - C C - G C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |