Sequence ID | >WENV180710854 |
Genome ID | ODFM01013581 |
Search identical group | |
Phylum/Class | [ODFM] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 609 |
End posion on genome | 517 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gtttccaagt |
tRNA gene sequence |
GGAGAGATGGCTGAGCTGGTCTAAGGCACTCGACTCGAAATCGAACGTGGGCTTTAAAAC |
Downstream region at tRNA end position |
gtttttcagt |
Secondary structure (Cloverleaf model) | >WENV180710854 Ser CGA t GCCA gtttttcagt G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T C G A G | | | | | G G G T C G G T G G G C G + | | T T T A G G C C T A A CGTGGGCTTTAAAACCCACC C A T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |