Sequence ID | >WENV180718491 |
Genome ID | ODGG01004878 |
Search identical group | |
Phylum/Class | [ODGG] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 1249 |
End posion on genome | 1322 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttgtcataat |
tRNA gene sequence |
GACTCGGTAGCTCAGCTGGTAGAGCACGACACTCTTAATGTTGGGGTCCAGGGTTCGATC |
Downstream region at tRNA end position |
ggttatacaa |
Secondary structure (Cloverleaf model) | >WENV180718491 Lys CTT t ACag ggttatacaa G - C A - T C - G T + G C - G G - C G - C C T T G T C C C A C G A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T A - T C - G A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |