Sequence ID | >WENV180728493 |
Genome ID | ODGU01053909 |
Search identical group | |
Phylum/Class | [ODGU] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 352 |
End posion on genome | 434 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcggagccga |
tRNA gene sequence |
GGCGGGTTGCCCGAGCGGCCAATGGGAGCTGACTGTAAATCAGCCGCGTAATGCTACGGG |
Downstream region at tRNA end position |
tgatcactcg |
Secondary structure (Cloverleaf model) | >WENV180728493 Tyr GTA a ACgc tgatcactcg G - C G - C C - G G - C G - C G - C T - A T A T C T C C C A C G A G | + | | | G G G C C C G G G G G C G + | | | T T C T G G G C A A A CGCGTAATGCTAC G - C C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |