Sequence ID | >WENV180731802 |
Genome ID | ODGW01016034 |
Search identical group | |
Phylum/Class | [ODGW] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 86 |
End posion on genome | 13 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
caaacggcaa |
tRNA gene sequence |
GCGCCCGTAGCTCAATGGATAGAGCATCTGATTACGGTTCAGAAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
cggcccccct |
Secondary structure (Cloverleaf model) | >WENV180731802 Arg ACG a GCag cggcccccct G - C C - G G - C C - G C - G C - G G - C T G T C T C C C A T A A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A AGGTT T - A C - G T - A G - C A - T T T T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |