Sequence ID | >WENV180733981 |
Genome ID | ODGZ01001752 |
Search identical group | |
Phylum/Class | [ODGZ] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 4918 |
End posion on genome | 4846 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gcacgtcgaa |
tRNA gene sequence |
GCCCCCGTAGCTCAGGGGATAGAGCACCGCCCTCCGGAGGCGGGTGCCGAGGTTCGAATC |
Downstream region at tRNA end position |
cagggccggc |
Secondary structure (Cloverleaf model) | >WENV180733981 Arg CCG a GCtt cagggccggc G - C C - G C - G C - G C - G C - G G - C T A T G C T C C A G G A A | | | | | G G C T C G C G A G G C G | | | | T T A G A G C T A A GTGC C - G C - G G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |