Sequence ID | >WENV180734421 |
Genome ID | ODGZ01008336 |
Search identical group | |
Phylum/Class | [ODGZ] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 2226 |
End posion on genome | 2151 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgcggcgatg |
tRNA gene sequence |
GTGGCTGTAGCTCAGTAGGTAGAGCGCCTGGTTGTGGTCCAGGAGGTCGCGGGTTCAAAC |
Downstream region at tRNA end position |
ctcactgatc |
Secondary structure (Cloverleaf model) | >WENV180734421 His GTG g CCCA ctcactgatc G - C T - A G - C G - C C - G T - A G - C C A T T G C C C A T G A A + | | | | A A C T C G G C G G G C G | | | | T T G G A G C T A G AGGTC C - G C - G T - A G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |