Sequence ID | >WENV180735941 |
Genome ID | ODHB01002029 |
Search identical group | |
Phylum/Class | [ODHB] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 4372 |
End posion on genome | 4448 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aaatgttttc |
tRNA gene sequence |
GGGCCTATAGCTCAGTCGGTTAGAGCCGCGGACTCATAATCCGTTGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cagtatgcgc |
Secondary structure (Cloverleaf model) | >WENV180735941 Ile2 CAT c ACCA cagtatgcgc G - C G - C G - C C - G C - G T + G A - T C G T C G C C C A T G A A | | | | | G C C T C G G C G G G C G | | | | T T G G A G C T T A C TGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |