Sequence ID | >WENV180736308 |
Genome ID | ODHB01022568 |
Search identical group | |
Phylum/Class | [ODHB] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 230 |
End posion on genome | 302 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caagcgccat |
tRNA gene sequence |
TCCCGCGTAGCTCAATGGCAGAGCATCCGACTGTTAATCGGACGGTTATTGGTTCGAGTC |
Downstream region at tRNA end position |
ccggaagccc |
Secondary structure (Cloverleaf model) | >WENV180736308 Asn GTT t GCag ccggaagccc T - A C - G C - G C - G G - C C - G G - C T G T T A A C C A A A A | | | | | G T C T C G A T T G G C G | | | | T T G G A G C C A A CGGTT T - A C - G C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |