Sequence ID | >WENV180744496 |
Genome ID | ODHJ01057160 |
Search identical group | |
Phylum/Class | [ODHJ] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 157 |
End posion on genome | 249 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tacccaagac |
tRNA gene sequence |
GGAGCGGTGGCTGAGAGGCTGAAAGCACTCCTTTGCTAAAGGAACGTACTGGCAAAACCG |
Downstream region at tRNA end position |
aagcctttct |
Secondary structure (Cloverleaf model) | >WENV180744496 Ser GCT c GCCA aagcctttct G - C G - C A - T G - C C - G G - C G - C T A T C T C C C A A G A G | | | | | G G G T C G G A G G G C G | | | T T C A A G C T G A A CGTACTGGCAAAACCGGTACC C A T - A C - G C - G T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |