Sequence ID | >W141073571 |
Genome ID | ASSG01000023 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Paenibacillus graminis RSA19 [ASSG] |
Start position on genome | 8839 |
End posion on genome | 8754 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttcataattT |
tRNA gene sequence |
GCGGTCATGGCGGAATTGGCAGACGCGCTGGCTTCAGGTGCCAGTGGTAGCAATATCGTG |
Downstream region at tRNA end position |
taaccaaaaa |
Secondary structure (Cloverleaf model) | >W141073571 Leu CAG T ATaa taaccaaaaa G - C C - G G - C G - C T - A C - G A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C C A G G TGGTAGCAATATCGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |