Sequence ID | >WENV180755116 |
Genome ID | ODHU01018097 |
Search identical group | |
Phylum/Class | [ODHU] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 127 |
End posion on genome | 42 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gctcatcggc |
tRNA gene sequence |
GGTGACGTGTCTGAGCGGCCGAAAGAGCTCGCCTCGAAAGCGAGTGTGGTGCAAGCCACC |
Downstream region at tRNA end position |
cagcccccgg |
Secondary structure (Cloverleaf model) | >WENV180755116 Ser CGA c GCag cagcccccgg G - C G - C T - A G - C A - T C - G G - C T A T C A C C C A C G A G | | | | | A G G T C T G T G G G C G | | | T T C A A G A C G A G TGTGGTGCAAGCCACC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |