Sequence ID | >WENV180759550 |
Genome ID | ODHY01033190 |
Search identical group | |
Phylum/Class | [ODHY] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 400 |
End posion on genome | 480 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
taaaaagcaa |
tRNA gene sequence |
GCCTGAGTGGCGGAATTGGTAGACGCGCACGACTCAAACTCGTGTTCTTCGGAGTGAGGG |
Downstream region at tRNA end position |
caatcctctt |
Secondary structure (Cloverleaf model) | >WENV180759550 Leu CAA a ACaa caatcctctt G + T C - G C - G T - A G - C A - T G - C T T T C T C C C A T A A G | | | | | G T G G C G G A G G G C G | | | T T G A C G C T A G G TTCTTCGGAGT C - G A - T C - G G - C A - T C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |