Sequence ID | >WENV180767895 |
Genome ID | ODIG01001187 |
Search identical group | |
Phylum/Class | [ODIG] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 3347 |
End posion on genome | 3271 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
cccattttgg |
tRNA gene sequence |
GCGCTCGTAGCTCAATTGGATAGAGCGACAGACTTCGGATCTGTAGGTTATGGGTTCGAC |
Downstream region at tRNA end position |
cttgaaagac |
Secondary structure (Cloverleaf model) | >WENV180767895 Arg TCG g GCCA cttgaaagac G - C C - G G - C C - G T + G C - G G - C T C T T A T C C A T A A A | | + | | G T C T C G A T G G G C G | | | | T T G G A G C A T A G AGGTT A - T C - G A - T G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |