Sequence ID | >WENV180773813 |
Genome ID | ODIJ01002549 |
Search identical group | |
Phylum/Class | [ODIJ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 66 |
End posion on genome | 149 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taaatatttc |
tRNA gene sequence |
GGGAAGATAGCGAAGAGGCTAAACGCGGCGGACTGTAAATCCGCTCCTTAGGGTTCAGTG |
Downstream region at tRNA end position |
ttctattatt |
Secondary structure (Cloverleaf model) | >WENV180773813 Tyr GTA c ACCA ttctattatt G - C G - C G - C A - T A - T G - C A - T T A T T C A C C A A G A A | | | | | G G A G C G A G T G G C G | | | T T C A C G C T A A G TCCTTAGGGTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |