Sequence ID | >WENV180773881 |
Genome ID | ODIJ01003682 |
Search identical group | |
Phylum/Class | [ODIJ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 5943 |
End posion on genome | 6018 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cccatattat |
tRNA gene sequence |
GAGCCATTAGCTCAGTCGGTAGAGCACATGACTTTTAATCATGGTGTCACTGGTTCGATT |
Downstream region at tRNA end position |
tttaaataaa |
Secondary structure (Cloverleaf model) | >WENV180773881 Lys TTT t ACCA tttaaataaa G - C A - T G - C C - G C - G A - T T - A T T T T G A C C A T G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A A GTGTC C - G A - T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |