Sequence ID | >WENV180777107 |
Genome ID | ODIL01000056 |
Search identical group | |
Phylum/Class | [ODIL] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 37322 |
End posion on genome | 37394 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gagagcgcca |
tRNA gene sequence |
AGGGGTATGGGGTAATTGGCAGCCCGACTGATTCTGGTTCAGTTAGTCTTGGTTCGAGTC |
Downstream region at tRNA end position |
agagggcctc |
Secondary structure (Cloverleaf model) | >WENV180777107 Gln CTG a GCgg agagggcctc A - T G - C G - C G - C G - C T - A A - T T G T G G A C C A T A A G | + | | | G T T G G G C T T G G C G + | | | T T G G C C C C A G TAGT A - T C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |