Sequence ID | >WENV180782655 |
Genome ID | ODIQ01000093 |
Search identical group | |
Phylum/Class | [ODIQ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 11402 |
End posion on genome | 11486 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agcttcaaat |
tRNA gene sequence |
ACGCGGGTGGTGAAATTGGTAGACACGCTACTTTGAGGGGGTAGTGCCGGTTACGGCGTG |
Downstream region at tRNA end position |
agaaagagag |
Secondary structure (Cloverleaf model) | >WENV180782655 Leu GAG t ACaa agaaagagag A - T C - G G - C C - G G - C G - C G - C T A T T A C T C A T A A G + | | | | A T A G T G G T G A G C G | | | T T G A C A C T A G G TGCCGGTTACGGCGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |