Sequence ID | >WENV180783540 |
Genome ID | ODIQ01010588 |
Search identical group | |
Phylum/Class | [ODIQ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 1810 |
End posion on genome | 1739 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ggctccatta |
tRNA gene sequence |
GCGGAATTAGCACATCGGTAGTGCACGGGCTTCCCAAGCCTGTGAGGCGGGTTCGACTCC |
Downstream region at tRNA end position |
agattataaa |
Secondary structure (Cloverleaf model) | >WENV180783540 Gly CCC a TCac agattataaa G - C C - G G - C G - C A - T A - T T - A T C T T G C C C A T A A + | | | | G C C A C G G C G G G C G | | | | T T G G T G C T A A TGAG C - G G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |