Sequence ID | >WENV180784478 |
Genome ID | ODIR01000313 |
Search identical group | |
Phylum/Class | [ODIR] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 28998 |
End posion on genome | 29071 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cctaatacat |
tRNA gene sequence |
GCGATAGTGGCGTAGTTGGTAACGCGCGACCTTGCCAAGGTCGAGACCGCGGGTTCGAGC |
Downstream region at tRNA end position |
ataacataaa |
Secondary structure (Cloverleaf model) | >WENV180784478 Gly GCC t TCtt ataacataaa G - C C - G G - C A - T T - A A - T G - C C G T T G C C C A T G A G + | | | | G T T G C G G C G G G C G | | | | T T G A C G C T A G AGACC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |