Sequence ID | >WENV180786247 |
Genome ID | ODIR01133536 |
Search identical group | |
Phylum/Class | [ODIR] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 224 |
End posion on genome | 148 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
ccacaattta |
tRNA gene sequence |
GCGCTCGTAGCTCAATTGGATAGAGCAACAGACTTCGGATCTGTAGGTTGAAGGTTCGAT |
Downstream region at tRNA end position |
cttttatatt |
Secondary structure (Cloverleaf model) | >WENV180786247 Arg TCG a ACCA cttttatatt G + T C - G G - C C - G T + G C - G G - C T T T T T T C C A T A A A + | | | | G T C T C G G A A G G C G | | | | T T G G A G C A T A A AGGTT A - T C - G A - T G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |