Sequence ID | >WENV180790599 |
Genome ID | ODIT01021681 |
Search identical group | |
Phylum/Class | [ODIT] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 243 |
End posion on genome | 168 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
catatttatg |
tRNA gene sequence |
GTGATCGTAGTTCAGTTGGTAGAGCGCCAGTTTGTGGCACTGGTTGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
taatatgagc |
Secondary structure (Cloverleaf model) | >WENV180790599 His GTG g CCCA taatatgagc G - C T - A G - C A - T T - A C - G G - C T G T T G C C C A T G A A + | | | | A T C T T G G C G G G C G | | + | T T G G A G C T A G TTGTC C - G C - G A - T G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |