Sequence ID | >WENV180792557 |
Genome ID | ODIW01000760 |
Search identical group | |
Phylum/Class | [ODIW] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 4951 |
End posion on genome | 5022 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtgaggtcaa |
tRNA gene sequence |
TGGGATATGGTGTAATGGTAACACTACAGATTCTGGTCCTGTCATTCCTGGTTCGAGTCC |
Downstream region at tRNA end position |
agtgagagag |
Secondary structure (Cloverleaf model) | >WENV180792557 Gln CTG a ACaa agtgagagag T - A G - C G - C G - C A - T T - A A - T T G T G G G C C A A A G | | + | | G T T G T G C C T G G C G | | | | T T G A C A C T A T CATT A - T C - G A - T G - C A C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |