Sequence ID | >WENV180805420 |
Genome ID | ODJH01000006 |
Search identical group | |
Phylum/Class | [ODJH] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 254468 |
End posion on genome | 254542 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttaaatgaac |
tRNA gene sequence |
GGCGGGATAGCTCAGTTGGTTAGAGCGTCGGATTCATAATCCGGAGGTCCGGGGATCGTA |
Downstream region at tRNA end position |
aaaggttgat |
Secondary structure (Cloverleaf model) | >WENV180805420 Met CAT c ACaa aaaggttgat G + T G - C C - G G - C G - C G - C A - T G A T G C C C C T T G A A | | | | | G T C T C G C G G G G C G | | | | A T G G A G C T T A G AGGTC T + G C - G G - C G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |