Sequence ID | >WENV180812870 |
Genome ID | ODJN01199021 |
Search identical group | |
Phylum/Class | [ODJN] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 3 |
End posion on genome | 76 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
nnnnnnnntt |
tRNA gene sequence |
GCGAAAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180812870 Gly GCC t TCnn nnnnnnnnnn G - C C - G G - C A - T A - T A - T A - T T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |