Sequence ID | >WENV180815289 |
Genome ID | ODJP01000161 |
Search identical group | |
Phylum/Class | [ODJP] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 58368 |
End posion on genome | 58454 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cactcggttt |
tRNA gene sequence |
GCCGCAATGGTGGAATTGGTAGACACGAGGGACTTAAAATCCCTTGGCCAGTAATGGCTG |
Downstream region at tRNA end position |
ttaaaataca |
Secondary structure (Cloverleaf model) | >WENV180815289 Leu TAA t ACtt ttaaaataca G - C C - G C - G G - C C - G A C A - T T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGGCCAGTAATGGCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |