Sequence ID | >WENV180815707 |
Genome ID | ODJP01001244 |
Search identical group | |
Phylum/Class | [ODJP] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 7615 |
End posion on genome | 7542 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
tatttaatat |
tRNA gene sequence |
CGCGGGTTGGAGCAGTTGGTAGCTCGCCAGGCTCATAACCTGGAGGTCGCATGTTCGAGT |
Downstream region at tRNA end position |
atttcgcagg |
Secondary structure (Cloverleaf model) | >WENV180815707 fMet CAT t ACtt atttcgcagg C A G - C C - G G - C G - C G - C T - A T G T C G T C C A T G A G | | | | G T C G A G G C A T G C G | | | | T T G G C T C T A G AGGTC C - G C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |