Sequence ID | >WENV180822976 |
Genome ID | ODJW01001450 |
Search identical group | |
Phylum/Class | [ODJW] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 2493 |
End posion on genome | 2566 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
agtgcagcaa |
tRNA gene sequence |
GCGCCATTAGCTCAATTGGTAGAGCAACTGACTCTTAATCAGTGAGTTCGGGGTTCGAGT |
Downstream region at tRNA end position |
attgattttt |
Secondary structure (Cloverleaf model) | >WENV180822976 Lys CTT a ACaa attgattttt G - C C - G G - C C - G C - G A - T T - A T G T G T C C C A T A A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A GAGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |