Sequence ID | >WENV180825777 |
Genome ID | ODJZ01000033 |
Search identical group | |
Phylum/Class | [ODJZ] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 50837 |
End posion on genome | 50763 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aatgcaatct |
tRNA gene sequence |
TCTTCAGTAGCTCAGTCGGTTAGAGCATCTGACTGTTAATCAGAGGGTCGTTGGTTCAAG |
Downstream region at tRNA end position |
agggagttcg |
Secondary structure (Cloverleaf model) | >WENV180825777 Asn GTT t GCtt agggagttcg T - A C - G T - A T - A C - G A - T G - C T G T C A A C C A T G A A | | | | | A C C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |