Sequence ID | >WENV180831945 |
Genome ID | ODKC01000281 |
Search identical group | |
Phylum/Class | [ODKC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 52210 |
End posion on genome | 52281 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaataagttg |
tRNA gene sequence |
CCACCCTTAGTGTAATGGATATCACGTAAGATTCCGGTTCTTGAGATGGGAGTTCGATTC |
Downstream region at tRNA end position |
cttaagcttg |
Secondary structure (Cloverleaf model) | >WENV180831945 Arg CCG g Atga cttaagcttg C - G C - G A - T C - G C - G C - G T - A T T T C T C T C A T A A A | + | | | G G T G T G G G G A G C G | | | T T A T C A C T A G AGAT T + G A - T A - T G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |