Sequence ID | >WENV180833225 |
Genome ID | ODKC01020741 |
Search identical group | |
Phylum/Class | [ODKC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 887 |
End posion on genome | 963 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaggaacac |
tRNA gene sequence |
GGACTCTTAGCTCAGTTGGTTAGAGCTATCGGCTCATAACCGATCGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
tattaaggag |
Secondary structure (Cloverleaf model) | >WENV180833225 Ile2 CAT c ACCA tattaaggag G - C G - C A - T C - G T - A C - G T - A T G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A T CGGTC A - T T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |