Sequence ID | >WENV180836769 |
Genome ID | ODKG01000069 |
Search identical group | |
Phylum/Class | [ODKG] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 1630 |
End posion on genome | 1702 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttgacatttt |
tRNA gene sequence |
GGCCCATTCGTCTATCGGCTAGGACGCAAGATTTTCATTCTTGAAAGAGGGGTTCGATTC |
Downstream region at tRNA end position |
taaacaggat |
Secondary structure (Cloverleaf model) | >WENV180836769 Glu TTC t ACaa taaacaggat G + T G - C C - G C - G C - G A - T T - A T T T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C T A G AAAG C - G A - T A - T G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |