Sequence ID | >WENV180838532 |
Genome ID | ODKG01113423 |
Search identical group | |
Phylum/Class | [ODKG] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 206 |
End posion on genome | 131 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttgtcacgc |
tRNA gene sequence |
TGGGGTGTAGCCAAGCAGGTAAGGCAACGGGTTTTGGTCCCGTCATTCGAGGGTTCAAGT |
Downstream region at tRNA end position |
tttttttgcg |
Secondary structure (Cloverleaf model) | >WENV180838532 Gln TTG c GCCA tttttttgcg T - A G - C G - C G - C G - C T + G G - C T G T C T T C C A C G A A | | + | | A A A C C G G A G G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |