Sequence ID | >WENV180839592 |
Genome ID | ODKI01023424 |
Search identical group | |
Phylum/Class | [ODKI] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 246 |
End posion on genome | 318 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tacaaaataa |
tRNA gene sequence |
GCGCCACTAGCTCAGCTGGCAGAGCACCTGACTCTTAATCAGGGTGTCCAGGGTTCGAAC |
Downstream region at tRNA end position |
aaaggtaccg |
Secondary structure (Cloverleaf model) | >WENV180839592 Lys CTT a Attg aaaggtaccg G - C C - G G - C C - G C - G A - T C - G C A T G T C C C A C G A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C C A A GTGTC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |