Sequence ID | >W141082236 |
Genome ID | ATTA01000015 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Mannheimia haemolytica MhSwine2000 [ATTA] |
Start position on genome | 4938 |
End posion on genome | 4849 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttgttgattc |
tRNA gene sequence |
GGTGAGATGTCCGAGTGGTTGAAGGAGCACGCCTGGAAAGCGTGTATATGGGAAACTGTA |
Downstream region at tRNA end position |
ttcatactga |
Secondary structure (Cloverleaf model) | >W141082236 Ser GGA c GCCA ttcatactga G - C G - C T - A G - C A - T G - C A - T T A T C C C C C A T G A G | | | | | G G G C C T G G G G G C G | | | T T T A G G A T G A G TATATGGGAAACTGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |