Sequence ID | >WENV180841763 |
Genome ID | ODKK01005647 |
Search identical group | |
Phylum/Class | [ODKK] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 52 |
End posion on genome | 144 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
tcgtggccgc |
tRNA gene sequence |
GCCCCCATAGCTCAGCGGTTAGAGCAGCGAGCTTATACCTCGTATCGTGCCTGATAAGCA |
Downstream region at tRNA end position |
tcgccccttt |
Secondary structure (Cloverleaf model) | >WENV180841763 Ile TAT c ACtg tcgccccttt G + T C - G C - G C - G C - G C - G A - T T A T G A C C C A C G A A | | | | | G G C T C G C T G G G C G | | | | T T T G A G C T A A ATCGTGCCTGATAAGCACAAGGTC G + T C - G G - C A - T G - C C C T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |