Sequence ID | >WENV180847183 |
Genome ID | ODKT01049168 |
Search identical group | |
Phylum/Class | [ODKT] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 346 |
End posion on genome | 422 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aactatatgt |
tRNA gene sequence |
GCACTCATAGCTCAATTGGATAGAGCATCTGACTTCGGATCAGAGGGTTGTGGGTTCAAG |
Downstream region at tRNA end position |
ttttttaaaa |
Secondary structure (Cloverleaf model) | >WENV180847183 Arg TCG t GCCA ttttttaaaa G + T C - G A - T C - G T + G C - G A - T T G T C A T C C A T A A A | | + | | A T C T C G G T G G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |