Sequence ID | >WENV180849628 |
Genome ID | ODKV01000796 |
Search identical group | |
Phylum/Class | [ODKV] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 23204 |
End posion on genome | 23280 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cccaccatac |
tRNA gene sequence |
GGCCCGGTAGTTCAGCTGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCAGGGGTTCGAG |
Downstream region at tRNA end position |
tattcgcctc |
Secondary structure (Cloverleaf model) | >WENV180849628 Asp GTC c GCCA tattcgcctc G - C G + T C - G C - G C - G G - C G - C C G T T C C C C A C G A A | | | | | G T C T T G A G G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |