Sequence ID | >WENV180849723 |
Genome ID | ODKV01001024 |
Search identical group | |
Phylum/Class | [ODKV] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 27378 |
End posion on genome | 27304 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ctcgaaagac |
tRNA gene sequence |
GGCCCGTTGGTCAAGAGGTTAAGACACGGCCCTTTCACGGCTGTAACATGGGTTCGATTC |
Downstream region at tRNA end position |
tgtcggaacc |
Secondary structure (Cloverleaf model) | >WENV180849723 Glu TTC c ACCA tgtcggaacc G - C G + T C - G C - G C - G G - C T - A T T T T G C C C A A G A G | + | | | G G A C T G A T G G G C G | | | T T T A G A C T A A TAAC C - G G + T G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |