Sequence ID | >WENV180851000 |
Genome ID | ODKV01019660 |
Search identical group | |
Phylum/Class | [ODKV] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 2298 |
End posion on genome | 2223 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
naagatatat |
tRNA gene sequence |
CGCGGGATGGAGCAGTTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGGAGGTTCGAGT |
Downstream region at tRNA end position |
aaggggccga |
Secondary structure (Cloverleaf model) | >WENV180851000 fMet CAT t ACCA aaggggccga C T G - C C - G G - C G - C G - C A - T T G T C C T C C A T G A G | | | | | G T C G A G G G A G G C G | | | | T T G G C T C C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |