Sequence ID | >WENV180852177 |
Genome ID | ODKW01000043 |
Search identical group | |
Phylum/Class | [ODKW] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ttctctcact |
tRNA gene sequence |
GGTCCTATAGCTCAGTCGGTTAGAGCACCTGACTCATAATCAGGGAGTCCTTGGTTCAAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180852177 Ile2 CAT t ACnn nnnnnnnnnn G - C G - C T - A C - G C - G T + G A - T C G T G A A C C A T G A A | | | | | A C C T C G C T T G G C G | | | | T T G G A G C T T A A GAGTC C - G C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |