Sequence ID | >WENV180856580 |
Genome ID | ODKZ01032811 |
Search identical group | |
Phylum/Class | [ODKZ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 279 |
End posion on genome | 203 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cgagtcaaac |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCGCATCCCTGATAAGGATGAGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
ccggttgaac |
Secondary structure (Cloverleaf model) | >WENV180856580 Ile GAT c ACCA ccggttgaac G - C G - C G - C C - G C - G T - A A - T T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |