Sequence ID | >WENV180857129 |
Genome ID | ODLA01004746 |
Search identical group | |
Phylum/Class | [ODLA] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 199 |
End posion on genome | 114 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtgttttgtt |
tRNA gene sequence |
GGAGGATTCGCCTAGCGGCCTATGGCGCACGCCTGGAACGCGTGTTGGGTTCACGCCCTC |
Downstream region at tRNA end position |
tttccccggc |
Secondary structure (Cloverleaf model) | >WENV180857129 Ser GGA t GCtc tttccccggc G - C G - C A - T G - C G - C A - T T - A T A T C C C C C A C G A C | | | | | A G T C C G G G G G G C G | | | T T C T G G C C T A G TTGGGTTCACGCCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |