Sequence ID | >WENV180858247 |
Genome ID | ODLC01002344 |
Search identical group | |
Phylum/Class | [ODLC] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 5258 |
End posion on genome | 5184 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccatacatta |
tRNA gene sequence |
GCCCCGTTCGTTCAGTGGTTAGGACATCAGATTTTCACTCTGGAAACAGGGGTTCAATTC |
Downstream region at tRNA end position |
ttaaaatatt |
Secondary structure (Cloverleaf model) | >WENV180858247 Glu TTC a ACCA ttaaaatatt G + T C - G C - G C - G C - G G - C T - A T T T T C C C C A T G A C | | | | | A G C T T G A G G G G C G | + | | T T T G G A C T A A AAAC T + G C - G A - T G - C A - T T C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |