Sequence ID | >WENV180859406 |
Genome ID | ODLD01000624 |
Search identical group | |
Phylum/Class | [ODLD] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 17597 |
End posion on genome | 17515 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gccagcgttc |
tRNA gene sequence |
GGCAGGTTGCCCGAGCGGCCAAAGGGAGCGGTCTGTAAAACCGTCGGCGTTGCCTACGTT |
Downstream region at tRNA end position |
ccccggatcg |
Secondary structure (Cloverleaf model) | >WENV180859406 Tyr GTA c ACtg ccccggatcg G - C G - C C - G A - T G - C G - C T - A T A T C A A C C A C G A G | | | | | A G G C C C G T T G G C G | | | T T C A G G G C A A A CGGCGTTGCCTAC G + T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |