Sequence ID | >WENV180860327 |
Genome ID | ODLD01046445 |
Search identical group | |
Phylum/Class | [ODLD] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 575 |
End posion on genome | 501 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aatatccttt |
tRNA gene sequence |
GGCCCTATAACTCAGTTGGTTAGAGTAGCTGACTCATAATCAGCAAGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
tttataaaac |
Secondary structure (Cloverleaf model) | >WENV180860327 Ile2 CAT t ACat tttataaaac G - C G - C C - G C - G C - G T + G A - T C G T G A A C C A T G A A | | | | | G T C T C A C T T G G C G | | | | T T G G A G T T T A A AAGTC G - C C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |