Sequence ID | >WENV180861606 |
Genome ID | ODLE01006877 |
Search identical group | |
Phylum/Class | [ODLE] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 1314 |
End posion on genome | 1226 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tggtaagttt |
tRNA gene sequence |
GGTGAGATGGCAGAGTGGCCTAATGCACTGACCTGCTAAGTCAGAGTACCGTTTCGGTAC |
Downstream region at tRNA end position |
tattattaat |
Secondary structure (Cloverleaf model) | >WENV180861606 Ser GCT t GCCA tattattaat G - C G - C T - A G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | A G G A C G G A G G G C G | | | T T C A T G C C T A A AGTACCGTTTCGGTACC C - G T - A G - C A - T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |