Sequence ID | >WENV180863949 |
Genome ID | ODLH01004970 |
Search identical group | |
Phylum/Class | [ODLH] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 4369 |
End posion on genome | 4459 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cgtaaagcac |
tRNA gene sequence |
GGAGGAGTACCCAAGAGGCTGAAGGGTCCGCACTCGAAATGCGGTAGGTCGGGCAACCGG |
Downstream region at tRNA end position |
ttcttttaaa |
Secondary structure (Cloverleaf model) | >WENV180863949 Ser CGA c GCCA ttcttttaaa G + T G - C A - T G - C G - C A - T G - C T A T C T C C C A A G A A | + | | | A G A C C C G G G G G C G | | | T T C A G G G T G A T TAGGTCGGGCAACCGGCGC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |