Sequence ID | >WENV180865615 |
Genome ID | ODLJ01000217 |
Search identical group | |
Phylum/Class | [ODLJ] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 23145 |
End posion on genome | 23218 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tttaagctat |
tRNA gene sequence |
CGGGATGTAGCGCAGTTGGTAGCGCACTACGTTCGGGACGTAGGGGTCGCCAGTTCGACT |
Downstream region at tRNA end position |
aaaaagggaa |
Secondary structure (Cloverleaf model) | >WENV180865615 Pro CGG t ACag aaaaagggaa C - G G - C G - C G - C A - T T - A G - C T C T T G G T C A T G A A + | | | | G T C G C G G C C A G C G | | | | T T G G C G C T A A GGGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |